circad | circRNAs associated with diseases

Circular RNA CCDC66
Gene	CCDC66	Organism	Human
Genome Locus	chr3:56626997-56628056:+	Build	hg19
Disease	Hirschsprung's Disease	ICD-10	Hirschsprung disease (Q43.1)
DBLink	Link to database	PMID	30443988
Experimental Method
Sample Type	Tissues	Comparison	Patient tissues vs control
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ATGACTGCTCTCTTGGACCC Reverse GCAGTACTGTTTCCTGATGCT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Wen, Z, Shen, Q, Zhang, H, Su, Y, Zhu, Z, Chen, G, Peng, L, Li, H, Du, C, Xie, H, Xu, X, Tang, W (2019). Circular RNA CCDC66 targets DCX to regulate cell proliferation and migration by sponging miR-488-3p in Hirschsprung's disease. J. Cell. Physiol., 234, 7:10576-10587.